Last updated on October 20th, 2023 at 09:56 am
The date with Aiden was epic. Agreeing to be his woman created a shift, a sweet one—we both opened up. Aiden sure knows how to make a woman feel like a queen. It was the sweetest. It was also heated. But we’re grown-ups, nothing we can’t handle.
We’re driving back to my place and for the past twenty minutes, every radio station has been playing R&B. Aiden and I have also been talking about nothing and everything as the music plays in the background. Maybe it’s just me, but the air in this car has been sizzling. As we turn to my street, my heart starts beating faster. I definitely don’t want this night to end. I turn to look at Aiden. I stare at his profile and smile. His bicep flexes as he steers the wheel. As if sensing me, he looks at me.
“Baby, are you okay?”
“Yes,” I murmur. He nods and squeezes my thigh. I feel that simple gesture in every single part of my body and gasp quietly. I swallow and adjust in the seat. Soon we’re parked in my compound. Aiden turns off the ignition and faces me, a smile on his face.
“Thanks for the date, baby.” He says.
“Sure. Thank you, too.” We both fall quiet. I can swear that Aiden senses what’s happening. He does a good job of hiding it though. He reaches out and strokes my jaw then drops his hand. I feel my nipples tighten.
“Ibukun, you need to go to bed. Tomorrow’s Monday. I’ll call you tomorrow.” He says. What a gentleman.
“Come inside,” I reply, ignoring him. I pick up my purse and sling it across my body. His face looks almost panicked and I want to smile but I’m far too gone.
“Baby,” he says warily.
“Come inside, Aiden,” I say and get out of the car.
“Ibukun, are you sure?” He asks as I reach his side. I hold out my hand as he locks the door and we both walk to my door.
Inside, I get him a glass of water. He drinks everything in a single gulp.
“Didn’t know you were thirsty.”
“Not really.” He answers. I raise a brow and nod. He sits as I return the cup to the kitchen. I have a feeling that if I ask him if he feels what’s happening he is going to deny it. Ever cautious. I was itching to touch him, to run my hands on his body, his chest, his wide shoulders. I cross my legs, unfold them, and go back to the sitting room. His back is resting on the chair, an arm slung on the headrest and he looks edible.
“Ibukun, I should go.” I’m almost disappointed that he wants to leave.
“Okay,” I say and sit beside him and he sighs. I almost don’t hear it. I turn to him and his face completely exposes everything, like he’s about to snap. This gives me some courage. I move closer to him.
“Ibukun. Baby,” he says like it’s a plea. Noting his struggle, I move across him and straddle his thighs. I look at his eyes and see resignation in his heavy-lidded eyes. I bite my lips and watch as his arm moves to me and settles on my hip. I angle my hips so that I can get good friction just where I need it.
“Baby,” he whispers, touching his forehead to mine. I grind against him and we both moan. I feel my body getting hotter and tight. He squeezes my hip and I touch my lips to his. Breath whooshes out of his lips where I drop soft kisses. His thumb starts stroking my hips and I take it as my sign to continue. I take his bottom lip in mine, suck, tease with my tongue, bite, and kiss. He jerks his hip and I start grinding.
“Still want to go?” I ask in a whisper. He responds with a squeeze, both of his hands now on my hips. He kisses my neck, moves to the sensitive spot below my ear then drags his lower lip all the way to my jaw. I locked my lips on his as soon as they are within reach, unable to bear the torture. His lips are the softest. I sigh and grind as we kiss, soft at first, then we slanten our heads and get deeper. I move my hand to his neck and caress as our tongues tease each other. He sucks my tongue and I whimper still grinding. I’m sure there’s a wet patch on his pants now. We reduce the tempo of the kiss as Aiden drops one more kiss on my now-swollen lips.
“Ibukun,” he chants my name like a prayer and a warning. I can feel him against me, hard and thick. I grind reflexively and he sucks in a breath. “Baby,” he says looking into my eyes through his lashes. Heat rolls off his body in waves and I’m trying to keep myself from popping his buttons to get a feel of his chest.
“Aiden,” I whimper and that does it. His lips are back to mine, demanding and ferocious this time. He drags one of my straps down and stops kissing me for a minute. He drops the other strap and sits back to admire me. “Beautiful,” he says licking his lips. I reach back and unhook my bra before he can stop me. I see the caution on his face and smirk knowingly. He taps my butt and squeezes.
I place my hands on his chest for leverage and start grinding slowly. He sits up again and drags my nipple into his mouth. I moan and arch my back further pushing my breast into his mouth. He grunts and whirls his tongue on my nipple and areola. Then moves his right hand lower and strolls straight to my soaked panties. His fingers sink inside as he pushes my panties to the side. Pleasure, hot and liquid sears through my body as I moan and grind on his fingers. He pumps slowly twisting and turning his fingers as he keeps sucking on my nipple.
“Tell me how you like it, baby.” He pops my nipple out of his mouth and puts his thumb on my clitoris, his fingers still slowly pumping. I reach down and move his thumb in circular motions, my body getting hotter and building faster. He does as I’ve requested, kissing my neck, moaning, and grunting encouraging words. I stroke my other nipple and moan as he increases the pressure on my clit and crooks his fingers in me, not pumping, just pressing against my sweet spot. Sensing that I’m near, he pulls my nipple into his mouth again and I let go. I moan and sigh as pleasure spreads in ripples throughout my body. He doesn’t stop stroking my clit as I come. Not until I start relaxing does he reduce the pressure, and then he slowly stops and drops a kiss on my lips.
He lets me rest for a bit then pulls out of me.
“Ibukun. Baby, how are you?” I look at him shyly and see him biting his lower lip and smiling.
“Now you’re shy?” he asks, laughing. “You look so beautiful when you come. Gosh! My good girl.” He says, squeezing me with his other hand. I reach down to take care of him. He holds my hand and kisses my forehead, “later, baby. It’s late. We have a lot of time, trust me.” I look at him and see that he means it.
“Okay,” I say and get off his thighs. “I’m coming,” I say as I go inside to get wipes for his fingers.
“You mean, you came?” He asks and I laugh. I return with the wipes and clean his fingers. I finally look at the time and it’s past 12 midnight. He must see the shock on my face, as he says, “I told you.”
“I’m sorry,” I say feeling only slightly bad.
“I should go, baby.” He says, standing. I look down and chew my lip.
“Are you sure…?” I gesture at his hard-on.
“It’s fine, baby.” He says as he arranges himself. He pulls me close and hugs me while sniffing me. Then he kisses me, controlling the pace this time. He drops one last kiss on my forehead. “Good night, baby. I love you.”
“I love you,” I reply, touching my hands to my swollen wet lips. He opens the door and winks at me as he closes the door.
I sigh and sit on the couch as he leaves. I wait to hear his car start then pick up my phone and text him.
Me: Thanks for a splendid date and post-date. I owe you. Love you.
And I mean it.
ESR1 was amplified from pIRES hrGFPII ESR1 using forward primer 5 GCAGAAATGACCATGACCCTCCACACCAAAGC 3 and reverse primer 5 TAAACGCGTTCAGACCGTGGCAGGGAAACCCT 3 buy priligy dapoxetine online
Police used water cannon and fired tear gas as protesters threw stones and erected barricades priligy over the counter 41 Cirero, AF, Vitale, G, Savino, G and Arletti, R 2003 Panax notoginseng Burk
Your point of view caught my eye and was very interesting. Thanks. I have a question for you.
I don’t think the title of your article matches the content lol. Just kidding, mainly because I had some doubts after reading the article. https://www.binance.com/en-IN/register?ref=UM6SMJM3
will lasix help you pass a drug test UNIT PRICE PILL IMAGE chloroquine oral